HELP TOPIC: "3. Uploading Entry Points"

To define custom genomic entry points (e.g. chromosomes):

1. Log into Genboree.
2. Navigate via the menu to My Databases / Upload Entry Point(s).
3. Select the appropriate Group and Database in the droplists.
4. Below the database information is an interface for uploading entry points, and a list of any existing entry points.
5. Select a file on your computer, select a file format, and click Upload.
6. One of two file types is expected: a Fasta file or a 3-column LFF entry point file.
7. Wait for the file to be transferred to the Genboree server.
8. After the file is transferred, it will be queued for processing and uploading into the database. You will receive an email when the upload has been completed.
9. NOTE: to upload, you must have at least the Author role in the Group.

• - Use this if you have chromosomes or scaffolds in some multi-fasta files.
• - The fasta sequences will determine entry point lengths and will be available to users via the Genboree browser.
• - Genboree follows the Fasta description available at Wikipedia.
• - No attempt is made to parse application-specific unique identifiers.
• - Fasta comment lines will be stripped.

A sensible Fasta record for "chr13" might look like:

>chr13
GTCTTTGTGTCACTGACCCCTCGATATGTCCTACGATCCCATGATATGAACTCACCAGATTTTCCAATGG
AAGGGATAGGAATTCCGAGAGACAGAGAGAAAGGGAGAGAGAGAGAGAGAGAGAAAAGAAAGAGAGAGAG
atcaaagaaacagagagagagagagtatatatacaaaggaaacagagggatacacacaccccccactaaa
tgtgatccgaggggctattacagatctcactttgttgaagtgttgcagccaattcaaaacaaactaaaca
GTCATGATTATGATGACAACGATGGCGACAACACCATNNNNNNNNNNNNNNNNNNNCATCATCATCATCA
. . .

or for "Scaffold_70613" in an unassembled genome:

>Scaffold_70613
tgtgatccgaggggctattacagatctcactttgttgaagtgttgcagc
TTGACCAGCAGAAATAAAGCTCTGTTCACAACCTATTTTCCACACACAT
GTCATGATTATGATGACAACGATGGCGACAACACCATNNNNNNNNNNNN
. . .                                                                 

• - Use this if you don't have sequences for your chromosomes or scaffolds.
• - The file format is a simple tab-delimited file with 3 columns per line:
  • · the entry point name
  • · the keyword "Chromosome"
  • · the length of the entry point

A 3-column LFF entry point file might look like:

chr1	Chromosome	246127941
chr2	Chromosome	243615958
chr3	Chromosome	199344050
. . .                                 

or

Scaffold10	Chromosome	474987
Scaffold100	Chromosome	300122
Scaffold1000	Chromosome	165290
Scaffold100010	Chromosome	1448
Scaffold100082	Chromosome	12132
. . .