|
|||||||||
Strand-specific, shotgun sequencing of mRNA from the H1 cell line
Strand-specific, shotgun sequencing of mRNA from the H1 cell line
Project News:
2009/8/10: EXPERIMENT XML file 'ecker.mRNA-seq_h1_r1.experiment.xml' uploaded
alias: mRNA-seq_h1_r1
expected_number_runs: 2 expected_number_spots: 40000000 expected_number_reads: 30000000 center_name: UCSD STUDY_REF: The San Diego Epigenome Center SAMPLE_DESCRIPTOR: H1_r1 LIBRARY LIBRARY_NAME: mRNA-seq_h1_r1 LIBRARY_STRATEGY: mRNA-Seq LIBRARY_SOURCE: RNA LIBRARY_SELECTION: cDNA LIBRARY_LAYOUT: SINGLE LIBRARY_CONSTRUCTION_PROTOCOL: Total RNA was isolated from H1 cells and mRNA isolated by RiboMinus depletion of rRNA. mRNA was fragmented, dephosphorylated, 5' phosphorylated, then sequentially ligated to the adenylated 3' RNA adapter then to the 5' RNA adapter. Following reverse transcription of the adapter ligated RNA, the library was enriched by 15 cycles of PCR. SPOT SPOT_DECODE_SPEC: 1 0 Application Read Forward 1 PLATFORM ILLUMINA INSTRUMENT_MODEL: Illumina Genome Analyzer II CYCLE_SEQUENCE: normal CYCLE_COUNT: 87 BASE CALLS SEQUENCE_SPACE: Base Space BASE_CALLER: Bustard QUALITY SCORES Quality Type: phred QUALITY_SCORER: Bustard NUMBER_OF_LEVELS: 1 MULTIPLIER: 1 ATTRIBUTES EXPERIMENT_TYPE: mRNA-Seq EXTRACTION_PROTOCOL: mirVana miRNA isolation kit (Applied Biosystems), performed as per manufacturer's instructions to isolate total RNA, followed by treatment with DNaseI (Qiagen) for 30 min at room temperature EXTRACTION_PROTOCOL_MRNA_ENRICHMENT: 2 x RiboMinus (Life Technologies) rRNA depletion (5S, 5.8S, 12S, 18S, 28S) EXTRACTION_PROTOCOL_FRAGMENTATION: 15 min at 70 ?C with RNA Fragmentation kit (Ambion/Applied Biosystems) as per manufacturer's instructions MRNA_PREPARATION_INITIAL_MRNA_QNTY: 200 ng MRNA_PREPARATION_FRAGMENT_SIZE_RANGE: 50-400 bp RNA_PREPARATION_5'_RNA_ADAPTER_SEQUENCE: 5' GUUCAGAGUUCUACAGUCCGACGAUC RNA_PREPARATION_3'_RNA_ADAPTER_SEQUENCE: 5' UCGUAUGCCGUCUUCUGCUUGidT, 5' adenylated (Illumina) RNA_PREPARATION_REVERSE_TRANSCRIPTION_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGA RNA_PREPARATION_5'_DEPHOSPHORYLATION: Fragmented RNA was treated with 5 U Antarctic phosphatase (New England Biolabs) for 40 min at 37?C in the presence of 40 U RNaseOut followed by phosphatase heat inactivation at 65?C for 5 min. The RNA was purified using 66 µl SPRI beads (Agencourt) and eluted in 11 µl 10 mM Tris buffer pH 8.0. RNA_PREPARATION_5'_PHOSPHORYLATION: Phosphorylation was performed by addition of 10 U PNK (New England Biolabs), 1 mM ATP, and 20 U RNaseOut (Life Technologies) and incubation at 37?C for 1 h. RNA_PREPARATION_3'_RNA ADAPTER_LIGATION_PROTOCOL: 1 µl of 1:10 diluted adenylated 3? RNA adapter oligonucleotide was added to the phosphorylated RNA and incubated at 70?C for 2 min followed by placement on ice. The 3? RNA adapter ligation reaction was performed by addition of 2 µl 10x T4 RNA ligase 2 truncated ligation buffer, 1.6 µl 100 mM MgCl2, 20 U RNaseOut and 300 U T4 RNA ligase 2 truncated (New England Biolabs) and incubation at 22?C for 1 h. RNA_PREPARATION_5'_RNA_ADAPTER_LIGATION_PROTOCOL: Ligation of the 5? RNA adapter was performed by addition to the 3? adapter ligated reaction of 1 µl 1:1 diluted, heat denatured (70?C 2 min) 5? RNA adapter oligonucleotide, 1 µl 10 mM ATP, and 10 U T4 RNA ligase (Promega), and incubation at 20?C for 1 h. RNA was purified using 66 µl SPRI beads and eluted in 10 µl 10 mM Tris buffer pH 8.0. RNA_PREPARATION_REVERSE_TRANSCRIPTION_PROTOCOL: To the RNA ligation products, 2 µl 1:5 diluted RT primer was added and heat denatured (70?C 2 min), followed by incubation on ice. Added to the denatured RNA/primer solution was 4 µl 5x first strand buffer, 1 µl 12.5 mM dNTPs, 2 µl 100 mM DTT, and 40 U RNaseOut, followed by incubation at 48?C for 1 min. To this, 200 U Superscript II reverse transcriptase (Life Technologies) was added, followed by incubation at 44?C for 1 h. LIBRARY_GENERATION_PCR_TEMPLATE: The entire reverse transcription reaction was used in the PCR enrichment of the library. LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: Phusion hot-start high fidelity DNA polymerase (New England Biolabs). 1x Phusion polymerase buffer and 4 U Phusion hot-start high fidelity DNA polymerase was used in a 100 µl reaction. LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: 98?C 30 sec; 98?C 10 sec, 60?C 30 sec, 72?C 15 sec; 72?C 10 min LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 15 LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: 5' AATGATACGGCGACCACCGACAGGTTCAGAGTTCTACAGTCCGA LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGA LIBRARY_GENERATION_PCR_PRIMER_CONC: 0.25 µM LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: PCR products were purified in two steps, first by purification using 180 µl SPRI beads and elution in 30 µl 10 mM Tris buffer pH 8.0, followed by purification with 39 µl SPRI beads and elution in 10 µl 10 mM Tris buffer pH 8.0. |
|||||||||
|
|||||||||