Genboree BCM
Help Genboree Home
(This is a recently added feature. Report issues to Genboree Admin.)
Whole genome shotgun bisulfite sequencing of the H1 cell line
Whole genome shotgun bisulfite sequencing of the H1 cell line


Project News:
2009/6/30:
EXPERIMENT XML file 'ecker.methylC-seq_h1_r2.experiment.xml' uploaded



alias: methylC-seq_h1_r2
expected_number_runs: 16
expected_number_spots: 60000000000
expected_number_reads: 40000000000
center_name: UCSD

STUDY_REF: The San Diego Epigenome Center
SAMPLE_DESCRIPTOR: H1_r2

LIBRARY
LIBRARY_NAME: methylC-seq_h1_r2b
LIBRARY_STRATEGY: Bisulfite-Seq
LIBRARY_SOURCE: GENOMIC
LIBRARY_SELECTION: RANDOM
LIBRARY_LAYOUT: SINGLE
LIBRARY_CONSTRUCTION_PROTOCOL: Genomic DNA was purified from H1 human embryonic stem cells, sheared by sonication to 50-500 bp, ligated to methylated single-end Illumina adaptors, fragments of 140-210 bp isolated after agarose gel electrophoresis, bisulfite converted, amplified by PCR and sequenced using the Illumina Genome Analyzer II according to manufacturer's instructions

SPOT
SPOT_DECODE_METHOD: 0

PLATFORM
ILLUMINA
INSTRUMENT_MODEL: Illumina Genome Analyzer II
CYCLE_SEQUENCE: normal
CYCLE_COUNT: 87

BASE CALLS
SEQUENCE_SPACE: Base Space
BASE_CALLER: Bustard

QUALITY SCORES
Quality Type: phred
QUALITY_SCORER: Bustard
NUMBER_OF_LEVELS: 1
MULTIPLIER: 1

ATTRIBUTES
EXPERIMENT_TYPE: DNA Methylation
EXTRACTION_PROTOCOL: Qiagen DNeasy mini kit, performed as per manufacturer's instructions'
EXTRACTION_PROTOCOL_TYPE_OF_SONICATOR: Diagenode Bioruptor
EXTRACTION_PROTOCOL_SONICATION_CYCLES: 20 cycles of: 30 seconds on high power, 2 minutes off
DNA_PREPARATION_INITIAL_DNA_QNTY: 5 g
DNA_PREPARATION_FRAGMENT_SIZE_RANGE: 50-500 bp
DNA_PREPARATION_ADAPTOR_SEQUENCE: A: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG, B: 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
DNA_PREPARATION_ADAPTOR_LIGATION_PROTOCOL: Standard Illumina genomic DNA library preparation ligation protocol (15 minutes at room temperature), except the adapters contained methylcytosine and were supplied by Illumina
DNA_PREPARATION_POST-LIGATION_FRAGMENT_SIZE_SELECTION: Separation by electrophoresis on a 2% agarose gel followed by excision of 140-210 bp fragments
BISULFITE_CONVERSION_PROTOCOL: Standard Human Genetic Signatures MethylEasy Xceed bisulfite conversion kit protocol
BISULFITE_CONVERSION_PERCENT: 99.6% of cytosines converted based on shotgun sequencing of unmethylated lambda phage control spiked into original genomic DNA sample
LIBRARY_GENERATION_PCR_TEMPLATE_CONC: One third of the 140-210 nt adapter-ligated, bisulfite converted DNA was used in each 50 l PCR reaction
LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: Stratagene Pfu Turbo Cx
LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: 95?C 2 min; 98?C 30 sec, 4 cycles of 98?C 15 sec, 60?C 30 sec, 72?C 4 min; 72?C 10 min
LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 4
LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
LIBRARY_GENERATION_PCR_PRIMER_CONC: 25 M
LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: Separation by electrophoresis on a 2% agarose gel followed by excision of 180-300 bp fragments.

 

 


Bioinformatics Research Laboratory © 2001-2024 Baylor College of Medicine
Bioinformatics Research Laboratory
(400D Jewish Wing, MS:BCM225, 1 Baylor Plaza, Houston, TX 77030)