Genboree BCM
Help Genboree Home
(This is a recently added feature. Report issues to Genboree Admin.)
Bisulfite-Seq analysis of RRBS510 derived from human Fib 20 cells
RRBS REMC Sequencing on Illumina


Project News:
2011/1/31:
EXPERIMENT XML file 'BI.experiment.G2304.2011-01-31.xml' uploaded



alias: RRBS510
center_name: BI
expected_number_runs: 1

STUDY_REF: G2304
SAMPLE_DESCRIPTOR: hFib_20_p7

LIBRARY
LIBRARY_NAME: RRBS510
LIBRARY_STRATEGY: Bisulfite-Seq
LIBRARY_SOURCE: GENOMIC
LIBRARY_SELECTION: Reduced Representation
LIBRARY_LAYOUT: SINGLE
POOLING_STRATEGY: none
LIBRARY_CONSTRUCTION_PROTOCOL: Smith et al., Methods 48, 226-232

SPOT
NUMBER_OF_READS_PER_SPOT:
READ_INDEX: 0
READ_CLASS: Application Read
READ_TYPE: Forward
BASE_COORD: 1

PLATFORM
ILLUMINA
INSTRUMENT_MODEL: Illumina Genome Analyzer IIx
SEQUENCE_LENGTH: 36

BASE CALLS
GAPipeline 1.5.0

QUALITY SCORES
GAPipeline 1.5.0

ATTRIBUTES
BISULFITE_CONVERSION_PROTOCOL: 2x5hrs Epitect Kit
DNA_PREPARATION_INITIAL_DNA_QNTY: 20 ng
EXTRACTION_PROTOCOL_SONICATION_CYCLES: NA
DNA_PREPARATION_ADAPTOR_LIGATION_PROTOCOL: T4 Ligase (2,000U/ul) 16C o/n
DNA_PREPARATION_ADAPTOR_SEQUENCE: 5' P-GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTG and 5' ACACTCTTTCCCTACACGACGCTCTTCCGATCT
LIBRARY_GENERATION_PCR_R_PRIMER_SEQUENCE: 5' CAAGCAGAAGACGGCATACGAGCTCTTCCGATCT
DNA_PREPARATION_POST-LIGATION_FRAGMENT_SIZE_SELECTION: 130-250
BISULFITE_CONVERSION_PERCENT: >99%
EXTRACTION_PROTOCOL: Standard Protocol (Smith et al., Methods 48, 226-232)
LIBRARY_GENERATION_PCR_PRIMER_CONC: 25uM
DNA_PREPARATION_FRAGMENT_SIZE_RANGE: 40-160
EXPERIMENT_TYPE: DNA Methylation
LIBRARY_GENERATION_PCR_THERMOCYCLING_PROGRAM: Smith et al., Methods 48, 226-232
LIBRARY_GENERATION_PCR_PRODUCT_ISOLATION_PROTOCOL: Gel size selection
LIBRARY_GENERATION_PCR_F_PRIMER_SEQUENCE: 5' AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT
LIBRARY_GENERATION_PCR_TEMPLATE_CONC: NA
LIBRARY_GENERATION_PCR_POLYMERASE_TYPE: Pfu Turbo Cx hot start
LIBRARY_GENERATION_PCR_NUMBER_CYCLES: 15
EXTRACTION_PROTOCOL_TYPE_OF_SONICATOR: NA

 

 


Bioinformatics Research Laboratory © 2001-2024 Baylor College of Medicine
Bioinformatics Research Laboratory
(400D Jewish Wing, MS:BCM225, 1 Baylor Plaza, Houston, TX 77030)